What will the first 20 nucleotides of this mRNA sequence code for? Use as the stop codon. Your sister probably uses a computer program to decode the mRNA, but it's a short sequence so you use a codon table. Notice that the mRNA is the same as the 5' to 3' DNA sequence with uracils replacing thymines. What is the mRNA sequence made in this example?ĥ'ACTGCTGATGTTGAATTAGA 3' (No, this is 3' to 5' DNA sequence.)ĥ'ACUGCUGAUGUUGAAUUAGA 3' (That is correct.)ĥ'UGACGACUACAACUUAAUCU 3' (No, this is not the correct mRNA sequence.)ĥ'TGACGACTACAACTTAATCT 3' (No, this is 3' to 5' DNA sequence.) RNA polymerase reads the 3' to 5' DNA sequence to make mRNA. You read as much of the sequence as you can and write the sequence down in your sister's notebook.Īssuming that the DNA strand you just read is the 5' to 3' strand, what is the complement DNA sequence? Start with the 3' end of the DNA complement.ģ'ACTGCTGATGTTGAATTAGA 5' (No, this is the 5' to 3' DNA sequence.)ģ'ACUGCUGAUGUUGAAUUAGA 5' (No, this is an mRNA sequence.)ģ'UGACGACUACAACUUAAUCU 5' (No, this is an mRNA sequence.)ģ'TGACGACTACAACTTAATCT 5' (That is correct.)Īdenine bonds with thymine guanine bonds with cytosine. GACTAGTGCTCCTGGCCGTG (No, this is not correct.) You're going to read the sequence.įrom bottom to top, starting at the A, what is the sequence of the first 20 nucleotides?ĬTGCTGATGTTGAATTAGAG (No, the sequence starts with A.)ĪCGTACGTACGTACGTACGT (No, these are just the four nucleotides repeated.) Your sister has been trying to sequence a gene, and the autoradiogram of the sequencing gel is on her desk. You're now sitting at her desk waiting for her to come back. She invited you to visit her lab.īefore she could give you a tour, her supervisor called a quick lab meeting. Your sister is a molecular biology graduate student.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |